1,050

180

730

1,690

4,850

NBRP_Clawed_frogs_Newts_Top_EN.html
  1. Japanese / English

Search for X. laevis Living Resources

 

In this project, we provide X. laevis as research resources at the rates as follows.

All strains

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Unavail-able

Type: Mutant. Genetic Modification: Modified Artificially.

An albino line with CRISPR/Cas9-targeted mutations in tyrosinase (tyr.L and tyr.S) genes, made by the Ogino Lab. The target sequence are in exon 1 of tyr.L [GGGTCGATGATAGAGAGGAC] and tyr.S [GGCCCGTAGCAGAGCTGGTG].

Reference: https://pubmed.ncbi.nlm.nih.gov/35338712/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis Tg line carrying a CAG promoter driving ubiquitous Venus expression, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/15778984/
      https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis Tg line carrying a CMV promoter driving X. laevis Histone H2B fused to EGFP, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis Tg line carrying a CMV promoter driving X. laevis Histone H2B fused to mRFP1, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis Tg line carrying a CMV promoter driving a CAAX box of human HRAS fused to EGFP, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis double transgenic line carrying a CMV promoter driving X. laevis Histone H2B fused to mRFP1 and another CMV promoter driving a CAAX box of human HRAS fused to EGFP, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis double transgenic line carrying a CMV promoter driving a CAAX box of human HRAS fused to mRFP1 and another CMV promoter driving human LBR (1 - 238 a.a.) fused to EGFP, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/23480392/

Type: Transgenic. Genetic Modification: Modified Artificially.

A X. laevis Tg line carrying a CMV promoter driving human microtubule-associated protein tau (MAPT) fused to EGFP, made by the Ueno Lab.

Reference: https://pubmed.ncbi.nlm.nih.gov/11160831/

Please place your order by e-mail.

LBRS-EGFP

LBRS-Venus

RFP-Mem

EGFP-ER

RFP-ER

EGFP-Golgi

RFP-Golgi

EGFP-Mito

RFP-Mito

Dria-line

mcherry-βactin

EB3-EGFP

H2B-RFP/EGFP-Golgi

H2B-RFP/EGFP-Mito

SCAT3

SuperTOPEGFP

SuperTOPFlash

H3K9ac-EGFP

H3K9ac-mCherry

H4K20me1-EGFP

H4K20me1-mCherry

Strains that will be available in the future (please contact us if you wish to receive them)

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Please place your order by e-mail.

Type: Wild type. Genetic Modification: Unaltered.

Reference: https://pubmed.ncbi.nlm.nih.gov/8501439/

                   https://pubmed.ncbi.nlm.nih.gov/27762356/

User

Educational institution

Hiroshima University

Academia*

Company

Academia

in Japan

outside Japan

Embryo

(50 embryos)

Tadpole

(one tadpole)

Juvenile frog

(one frog)

Adult frog

(one frog)

Case

(order of embryos)

6.1. 2024 update

All prices are in Japanese yen (JPY).

Please send a e-mail to toyotat#hiroshima-u.ac.jp (replace “#” with “@”) to obtain X. laevis resources.

List of X. laevis living resources

*Other than Hiroshima University

  1. Xenopus laevis

950

160

660

1,520

4,360

Unavail-able

Unavail-able

Unavail-able

2,000

6,000