Search for X. laevis Living Resources > Resource Information
Search for X. laevis Living Resources > Resource Information
Official name: Xla.tyremOgino
Type: Mutant. Genetic Modification: Modified Artificially.
An albino line with CRISPR/Cas9-targeted mutations in tyrosinase (tyr.L and tyr.S) genes, made by the Ogino Lab. The target sequence are in exon 1 of tyr.L [GGGTCGATGATAGAGAGGAC] and tyr.S [GGCCCGTAGCAGAGCTGGTG].
Reference: https://pubmed.ncbi.nlm.nih.gov/35338712/
2023/09/18
Japanese / English
The cart-type online ordering system is currently under preparation. Please send your order to: NBRP Clawed Frogs and Newts Office E-mail: toyotat#hiroshima-u.ac.jp (replace "#" with "@")
Synonym: tyr
Copyright Ⓒ NBRP X. tropicalis. All rights reserved.